Review



pflag cmv 5a clec16a  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc pflag cmv 5a clec16a
    Pflag Cmv 5a Clec16a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+5a+clec16a/pBABEpuro+GFP-LC3+(Plasmid+%2322405)/pmc05780060__DB170321SupplementaryData-25-5-10
    Average 94 stars, based on 130 article reviews
    pflag cmv 5a clec16a - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Clec16a, Nrdp1, and USP8 Form a Ubiquitin-Dependent Tripartite Complex That Regulates β-Cell Mitophagy
    Article Snippet: .. Plasmids used for transfections included pFLAG-CMV-5a-Clec16a, pcDNA3.1 3x-HA-Nrdp1, MycUbiquitin, pBABEpuro-LC3-GFP (Addgene plasmid 22405, from the lab of Dr. Jayanta Debnath), mCherry-Parkin (Addgene plasmid 23956, from the lab of Dr. Richard Youle), and pDsRed2-mito (Clontech), all of which were previously described (1). pFLAG-CMV-5a-Clec16a-6xHis was generated by insertion of annealed oligos bearing the sequences (5’-TCGACCACCACCACCACCACCACGGTAC3’ and 5’- CGTGGTGGTGGTGGTGGTGG -3’) into a SalI-KpnI restriction site of the pFLAG-CMV-5aClec16a vector. .. Clec16a-EGFP was generated by ligation of the Clec16a ORF insert (derived from the pFLAG-CMV-5a-Clec16a vector) into the mEGFP-N1 vector (Addgene #54767, a gift from Dr. Michael Davidson). pGSTag-Clec16a-Flag and pGSTag-Nrdp1 were generated by ligation of the Clec16a ORFFlag fusion protein or the Nrdp1 cDNA into the pGSTag vector (Addgene #21877, a gift from Dr. David Ron). pcDNA3.1-Myc-Nrdp1 was generated by insertion of annealed oligos bearing the sequences (5’- AGCTTGCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGG-3’ and 5’- GATCCCAGATCCTCTTCTGAGATGAGTTTTTGTTCCATGGTGGCA-3’) into a HindIII-BamHI restriction site of the pcDNA3.1-3xHA-Nrdp1 vector, thereby eliminating the 3x-HA tag sequence. pcDNA3.1-3xHA-Nrdp1 C34S H36Q (CSHQ) was generated by site-directed mutagenesis of DNA sequences encoding the amino acids of interest utilizing the QuikChange II Site-directed mutagenesis kit per the manufacturer’s protocols (Agilent).

    Plasmid Preparation:

    Article Title: Clec16a, Nrdp1, and USP8 Form a Ubiquitin-Dependent Tripartite Complex That Regulates β-Cell Mitophagy
    Article Snippet: .. Plasmids used for transfections included pFLAG-CMV-5a-Clec16a, pcDNA3.1 3x-HA-Nrdp1, MycUbiquitin, pBABEpuro-LC3-GFP (Addgene plasmid 22405, from the lab of Dr. Jayanta Debnath), mCherry-Parkin (Addgene plasmid 23956, from the lab of Dr. Richard Youle), and pDsRed2-mito (Clontech), all of which were previously described (1). pFLAG-CMV-5a-Clec16a-6xHis was generated by insertion of annealed oligos bearing the sequences (5’-TCGACCACCACCACCACCACCACGGTAC3’ and 5’- CGTGGTGGTGGTGGTGGTGG -3’) into a SalI-KpnI restriction site of the pFLAG-CMV-5aClec16a vector. .. Clec16a-EGFP was generated by ligation of the Clec16a ORF insert (derived from the pFLAG-CMV-5a-Clec16a vector) into the mEGFP-N1 vector (Addgene #54767, a gift from Dr. Michael Davidson). pGSTag-Clec16a-Flag and pGSTag-Nrdp1 were generated by ligation of the Clec16a ORFFlag fusion protein or the Nrdp1 cDNA into the pGSTag vector (Addgene #21877, a gift from Dr. David Ron). pcDNA3.1-Myc-Nrdp1 was generated by insertion of annealed oligos bearing the sequences (5’- AGCTTGCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGG-3’ and 5’- GATCCCAGATCCTCTTCTGAGATGAGTTTTTGTTCCATGGTGGCA-3’) into a HindIII-BamHI restriction site of the pcDNA3.1-3xHA-Nrdp1 vector, thereby eliminating the 3x-HA tag sequence. pcDNA3.1-3xHA-Nrdp1 C34S H36Q (CSHQ) was generated by site-directed mutagenesis of DNA sequences encoding the amino acids of interest utilizing the QuikChange II Site-directed mutagenesis kit per the manufacturer’s protocols (Agilent).

    Generated:

    Article Title: Clec16a, Nrdp1, and USP8 Form a Ubiquitin-Dependent Tripartite Complex That Regulates β-Cell Mitophagy
    Article Snippet: .. Plasmids used for transfections included pFLAG-CMV-5a-Clec16a, pcDNA3.1 3x-HA-Nrdp1, MycUbiquitin, pBABEpuro-LC3-GFP (Addgene plasmid 22405, from the lab of Dr. Jayanta Debnath), mCherry-Parkin (Addgene plasmid 23956, from the lab of Dr. Richard Youle), and pDsRed2-mito (Clontech), all of which were previously described (1). pFLAG-CMV-5a-Clec16a-6xHis was generated by insertion of annealed oligos bearing the sequences (5’-TCGACCACCACCACCACCACCACGGTAC3’ and 5’- CGTGGTGGTGGTGGTGGTGG -3’) into a SalI-KpnI restriction site of the pFLAG-CMV-5aClec16a vector. .. Clec16a-EGFP was generated by ligation of the Clec16a ORF insert (derived from the pFLAG-CMV-5a-Clec16a vector) into the mEGFP-N1 vector (Addgene #54767, a gift from Dr. Michael Davidson). pGSTag-Clec16a-Flag and pGSTag-Nrdp1 were generated by ligation of the Clec16a ORFFlag fusion protein or the Nrdp1 cDNA into the pGSTag vector (Addgene #21877, a gift from Dr. David Ron). pcDNA3.1-Myc-Nrdp1 was generated by insertion of annealed oligos bearing the sequences (5’- AGCTTGCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGG-3’ and 5’- GATCCCAGATCCTCTTCTGAGATGAGTTTTTGTTCCATGGTGGCA-3’) into a HindIII-BamHI restriction site of the pcDNA3.1-3xHA-Nrdp1 vector, thereby eliminating the 3x-HA tag sequence. pcDNA3.1-3xHA-Nrdp1 C34S H36Q (CSHQ) was generated by site-directed mutagenesis of DNA sequences encoding the amino acids of interest utilizing the QuikChange II Site-directed mutagenesis kit per the manufacturer’s protocols (Agilent).



    Similar Products

    pflag-cmv-5a-6xhis clec16a internal idpr  (Thermo Fisher)
    90
    Thermo Fisher pflag-cmv-5a-6xhis clec16a internal idpr
    The CLEC16A internal IDPR is not a site of self-ubiquitination but is required for ubiquitin ligase activity.A, in vitro ubiquitination assay with recombinant <t>CLEC16A-6xHis-Flag</t> WT, ΔIDPR, or IDPR KR. Representative WB and immunoprecipitation (IP) following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h. n = 3/group. B, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT and Shuffle IDPR. Representative WB and IP following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h (n = 3/group). IDPR, intrinsically disordered protein region.
    Pflag Cmv 5a 6xhis Clec16a Internal Idpr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+5a+clec16a/pmc10066562-481-3-29
    Average 90 stars, based on 1 article reviews
    pflag-cmv-5a-6xhis clec16a internal idpr - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    pflag cmv 5a clec16a  (Addgene inc)
    94
    Addgene inc pflag cmv 5a clec16a
    The CLEC16A internal IDPR is not a site of self-ubiquitination but is required for ubiquitin ligase activity.A, in vitro ubiquitination assay with recombinant <t>CLEC16A-6xHis-Flag</t> WT, ΔIDPR, or IDPR KR. Representative WB and immunoprecipitation (IP) following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h. n = 3/group. B, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT and Shuffle IDPR. Representative WB and IP following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h (n = 3/group). IDPR, intrinsically disordered protein region.
    Pflag Cmv 5a Clec16a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+5a+clec16a/pBABEpuro+GFP-LC3+(Plasmid+%2322405)/pmc05780060__DB170321SupplementaryData-25-5-10
    Average 94 stars, based on 1 article reviews
    pflag cmv 5a clec16a - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    pflag-cmv-5a-clec16a  (Addgene inc)
    90
    Addgene inc pflag-cmv-5a-clec16a
    The CLEC16A internal IDPR is not a site of self-ubiquitination but is required for ubiquitin ligase activity.A, in vitro ubiquitination assay with recombinant <t>CLEC16A-6xHis-Flag</t> WT, ΔIDPR, or IDPR KR. Representative WB and immunoprecipitation (IP) following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h. n = 3/group. B, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT and Shuffle IDPR. Representative WB and IP following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h (n = 3/group). IDPR, intrinsically disordered protein region.
    Pflag Cmv 5a Clec16a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+5a+clec16a/pbabe+puro+dest+clec16a+flag/pmc05780060__DB170321SupplementaryData-25-41-10
    Average 90 stars, based on 1 article reviews
    pflag-cmv-5a-clec16a - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    The CLEC16A internal IDPR is not a site of self-ubiquitination but is required for ubiquitin ligase activity.A, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT, ΔIDPR, or IDPR KR. Representative WB and immunoprecipitation (IP) following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h. n = 3/group. B, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT and Shuffle IDPR. Representative WB and IP following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h (n = 3/group). IDPR, intrinsically disordered protein region.

    Journal: The Journal of Biological Chemistry

    Article Title: Reciprocal regulatory balance within the CLEC16A–RNF41 mitophagy complex depends on an intrinsically disordered protein region

    doi: 10.1016/j.jbc.2023.103057

    Figure Lengend Snippet: The CLEC16A internal IDPR is not a site of self-ubiquitination but is required for ubiquitin ligase activity.A, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT, ΔIDPR, or IDPR KR. Representative WB and immunoprecipitation (IP) following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h. n = 3/group. B, in vitro ubiquitination assay with recombinant CLEC16A-6xHis-Flag WT and Shuffle IDPR. Representative WB and IP following incubation with ATP, HA-Ubiquitin, E1, and the E2 conjugating enzyme UBE2D3 at 37 °C for 1 h (n = 3/group). IDPR, intrinsically disordered protein region.

    Article Snippet: For CD, the pFLAG-CMV-5a-6xHis CLEC16A internal IDPR only (AA 347–472) was generated by PCR amplifying the internal CLEC16A IDPR into pCR-BLUNT II TOPO backbone (Zero blunt TOPO cloning kit; Invitrogen, 450245), followed by sequence validation.

    Techniques: Activity Assay, In Vitro, Ubiquitin Assay, Recombinant, Immunoprecipitation, Incubation